Skip to Content

All products

Sort By Sort By: Featured
[1137-CMO-17] AAAAAAAAAAGTCAGACTTAAGTCGAGGTG (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

AAAAAAAAAAGTCAGACTTAAGTCGAGGTG (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

[0322-SR10030PA-1] Human Nanog Differentiation Reporter (pGreenZeo, plasmid) - 10 ug

Human Nanog Differentiation Reporter (pGreenZeo, plasmid) - 10 ug

[1444-PEH7358-20UG] Recombinant Human SCN10A Protein - 20 ug

Recombinant Human SCN10A Protein - 20 ug

[1444-PEH7358-50UG] Recombinant Human SCN10A Protein - 50 ug

Recombinant Human SCN10A Protein - 50 ug

[1444-PEH7358-100UG] Recombinant Human SCN10A Protein - 100 ug

Recombinant Human SCN10A Protein - 100 ug

[1444-PEH7358-500UG] Recombinant Human SCN10A Protein - 500 ug

Recombinant Human SCN10A Protein - 500 ug

[0965-ED0019Mo] Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA Kit (Qualitative) - 96-wells plate

Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA Kit (Qualitative) - 96-wells plate

[0801-EIA06285m] Mouse Poliovirus IgG (PV-IgG) ELISA Kit (Quantitative) - 96-wells plate

Mouse Poliovirus IgG (PV-IgG) ELISA Kit (Quantitative) - 96-wells plate

[0772-ED0019Mo] Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA kit (Qualitative) - 96-wells plate

Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA kit (Qualitative) - 96-wells plate

[1200-RG-1509] HEK293T NFAT-Luc2-KDR Reporter Cell Line - 1 vial of 5X10^6 cells

HEK293T NFAT-Luc2-KDR Reporter Cell Line - 1 vial of 5X10^6 cells

[1070-LSB-4x] ClearBand Laemmli Sample Buffer (4x) - 10 mL

ClearBand Laemmli Sample Buffer (4x) - 10 mL

[0544-MBS6508153-0.1ML] Mouse anti-Polio Virus 1 monoclonal antibody - 0.1 mL

Mouse anti-Polio Virus 1 monoclonal antibody - 0.1 mL

[0708-MRO-1209CQ-100UG] Recombinant Mouse Anti-MARV Antibody [Clone: FM11] - 100 ug (0.1 mg/mL)

Recombinant Mouse Anti-MARV Antibody [Clone: FM11] - 100 ug (0.1 mg/mL)

[0062-KG-701] Monkey Cynomolgus Spleen Genomic DNA - 0.1 mg

Monkey Cynomolgus Spleen Genomic DNA - 0.1 mg

[0804-HY-B0239R-25MG] Chloramphenicol (Standard) -25 mg

Chloramphenicol (Standard) -25 mg

[0804-HY-B0519AR-25MG] Tylosin (Standard) - 25 mg

Tylosin (Standard) - 25 mg

[0804-HY-B0502R-25MG] Enrofloxacin (Standard) - 25 mg

Enrofloxacin (Standard) - 25 mg

[0931-T9901A-709-1MG] VHH-His Isotype Control - 1 mg

VHH-His Isotype Control - 1 mg

[0855-ELK1149-96T] Human Interleukin 2 (IL-2) ELISA Kit - 96-wells plate

Human Interleukin 2 (IL-2) ELISA Kit - 96-wells plate

[0855-ELK1149HS-96T] Human Interleukin 2 (IL-2) ELISA Kit (High Sensitivity) - 96-wells plate

Human Interleukin 2 (IL-2) ELISA Kit (High Sensitivity) - 96-wells plate