Skip to Content
  • Low Price Guarantee 30 Days Online Returns Standard Shipping
  • Contact Us
Гентауър България
  • 0
    My Cart
  • Sign in
  • Продукти
  • Правила и условия
  • Home
  • Shop
  • Events
  • Blog
  • Appointment
  • Contact us
Гентауър България
  • 0
    • Продукти
    • Правила и условия
    • Home
    • Shop
    • Events
    • Blog
    • Appointment
    • Contact us
  • Low Price Guarantee 30 Days Online Returns Standard Shipping
  • Sign in
  • Contact Us

All products

  • NATtrol™
  • Molecular Diagnostic Controls
  • Lab Instruments
  • Recombinant Proteins
  • ELISA kit
  • Polyclonal Antibodies
  • Recombinant
  • Yeasen Hieff PCR
  • Plasmid vectors
  • Beads
  • Molecular Biology
  • HRP horseradish peroxidase
  • Strains
  • Nattrol PCR Controls
  • Magnetic
  • Control reagents
  • Biotin labelled
  • Mouse
  • E. coli Recombinant proteins
  • Media
  • Cell line
  • Monoclonal antibodies
  • DNA purification
  • Chemicals
Sort By Sort By: Featured
Featured Newest Arrivals Name (A-Z) Price - Low to High Price - High to Low
[1137-CMO-17] AAAAAAAAAAGTCAGACTTAAGTCGAGGTG (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

AAAAAAAAAAGTCAGACTTAAGTCGAGGTG (5' SH C6) - 200 nmol synthesis scale (HPLC purification)

[0322-SR10030PA-1] Human Nanog Differentiation Reporter (pGreenZeo, plasmid) - 10 ug

Human Nanog Differentiation Reporter (pGreenZeo, plasmid) - 10 ug

[1444-PEH7358-20UG] Recombinant Human SCN10A Protein - 20 ug

Recombinant Human SCN10A Protein - 20 ug

[1444-PEH7358-50UG] Recombinant Human SCN10A Protein - 50 ug

Recombinant Human SCN10A Protein - 50 ug

[1444-PEH7358-100UG] Recombinant Human SCN10A Protein - 100 ug

Recombinant Human SCN10A Protein - 100 ug

[1444-PEH7358-500UG] Recombinant Human SCN10A Protein - 500 ug

Recombinant Human SCN10A Protein - 500 ug

[0965-ED0019Mo] Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA Kit (Qualitative) - 96-wells plate

Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA Kit (Qualitative) - 96-wells plate

[0801-EIA06285m] Mouse Poliovirus IgG (PV-IgG) ELISA Kit (Quantitative) - 96-wells plate

Mouse Poliovirus IgG (PV-IgG) ELISA Kit (Quantitative) - 96-wells plate

[0772-ED0019Mo] Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA kit (Qualitative) - 96-wells plate

Mouse Anti-Poliomyelitis Virus 1-3 IgG ELISA kit (Qualitative) - 96-wells plate

[1200-RG-1509] HEK293T NFAT-Luc2-KDR Reporter Cell Line - 1 vial of 5X10^6 cells

HEK293T NFAT-Luc2-KDR Reporter Cell Line - 1 vial of 5X10^6 cells

[1070-LSB-4x] ClearBand Laemmli Sample Buffer (4x) - 10 mL

ClearBand Laemmli Sample Buffer (4x) - 10 mL

[0544-MBS6508153-0.1ML] Mouse anti-Polio Virus 1 monoclonal antibody - 0.1 mL

Mouse anti-Polio Virus 1 monoclonal antibody - 0.1 mL

[0708-MRO-1209CQ-100UG] Recombinant Mouse Anti-MARV Antibody [Clone: FM11] - 100 ug (0.1 mg/mL)

Recombinant Mouse Anti-MARV Antibody [Clone: FM11] - 100 ug (0.1 mg/mL)

[0062-KG-701] Monkey Cynomolgus Spleen Genomic DNA  - 0.1 mg

Monkey Cynomolgus Spleen Genomic DNA - 0.1 mg

[0804-HY-B0239R-25MG] Chloramphenicol (Standard) -25 mg

Chloramphenicol (Standard) -25 mg

[0804-HY-B0519AR-25MG] Tylosin (Standard) - 25 mg

Tylosin (Standard) - 25 mg

[0804-HY-B0502R-25MG] Enrofloxacin (Standard) - 25 mg

Enrofloxacin (Standard) - 25 mg

[0931-T9901A-709-1MG] VHH-His Isotype Control - 1 mg

VHH-His Isotype Control - 1 mg

[0855-ELK1149-96T] Human Interleukin 2 (IL-2) ELISA Kit - 96-wells plate

Human Interleukin 2 (IL-2) ELISA Kit - 96-wells plate

[0855-ELK1149HS-96T] Human Interleukin 2 (IL-2) ELISA Kit (High Sensitivity) - 96-wells plate

Human Interleukin 2 (IL-2) ELISA Kit (High Sensitivity) - 96-wells plate

  • 1
  • …
  • 167
  • 168
  • 169
  • …
  • 171
Clear Filters

Гентауър България

Лабораторно снабдяване
Изследователски, диагностични и ветеринарни лаборатории

Гентауър ЕООД
Ул. Искър 53
1191 Кокаляне,
София
Phone +35924682280
Fax +35929830070

  • +359 24 68 22 80
  • info@gentaur.com
Follow us
Авторско право © Гентауър ЕООД
Powered by Odoo - The #1 Open Source eCommerce