Hypothetical protein BG908_05820 201bp in pUC vector - 100ug plasmid + 200ul glycerol

(0 review)

725,20 лв 725.2 BGN 725,20 лв VAT Excluded

370,00 € VAT Excluded

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    DNA sequence: 

    RC46GOI: atgagaaattctacttataaacaaaacaaaatttttattttagcctatgttatatttggattgttcatgggtctattttttgacttattgttatcaactcacatatacacattaagtcttttaagtatattttttggcttttttatactaggagtaatctttaagattatcctttcatgccaaaataaaaaacatatttag

    Protein sequence: