pGreenII- 62- SK, 2ug

934,92 лв 934.9200000000001 BGN 934,92 лв

477,00 €

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days


    Catalog No. PVT11188
    Packing 2ug


    pGreenII-62-SK Information

    Function plant reporter plasmid

    Promoter: CaMV 35S

    Replicator: pSa ori, ori

    Plasmid classification: plant series, protein overexpression vector

    Plasmid size: 3347bp

    Prokaryotic resistance: Kan

    Cloned strain: DH5 alpha

    Culture conditions: 37 centigrade, aerobic LB

    Expression host: plant cells

    5'sequencing primers: 35S:GACGCACAATCCCACTATCC

    3'sequencing primers: primers designed according to sequence


    pGreenII-62-SK Description



    pGreenII-62-SK Sequence

    LOCUS       Exported                3347 bp ds-DNA     circular SYN 14-SEP-2016

    DEFINITION  synthetic circular DNA


    VERSION     .

    KEYWORDS    Untitled 10

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 3347)

      AUTHORS   .

      TITLE     Direct Submission

      JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1

    FEATURES             Location/Qualifiers

         source          1..3347

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         misc_feature    542..564

                         /note="LB T-DNA repeat"

                         /note="left border repeat from nopaline C58 T-DNA 


         promoter        638..982

                         /note="CaMV 35S promoter"

                         /note="strong constitutive promoter from cauliflower mosaic


         misc_feature    992..1099


                         /note="pBluescript multiple cloning site"

         primer_bind     1016..1032

                         /note="SK primer"

                         /note="common sequencing primer, one of multiple similar 


         primer_bind     complement(1066..1082)

                         /note="KS primer"

                         /note="common sequencing primer, one of multiple similar 


         polyA_signal    1153..1329

                         /note="CaMV poly(A) signal"

                         /note="cauliflower mosaic virus polyadenylation signal"

         misc_feature    1339..1363

                         /note="RB T-DNA repeat"

                         /note="right border repeat from nopaline C58 T-DNA"

         rep_origin      complement(1454..2042)



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


         CDS             complement(2213..3028)



                         /product="aminoglycoside phosphotransferase"


                         /note="confers resistance to kanamycin in bacteria or G418 

                         (Geneticin(R)) in eukaryotes"






         rep_origin      3319..407

                         /note="pSa ori"

                         /note="origin of replication from bacterial plasmid pSa"


            1 tttttatccc cggaagcctg tggatagagg gtagttatcc acgtgaaacc gctaatgccc

           61 cgcaaagcct tgattcacgg ggctttccgg cccgctccaa aaactatcca cgtgaaatcg

          121 ctaatcaggg tacgtgaaat cgctaatcgg agtacgtgaa atcgctaata aggtcacgtg

          181 aaatcgctaa tcaaaaaggc acgtgagaac gctaatagcc ctttcagatc aacagcttgc

          241 aaacacccct cgctccggca agtagttaca gcaagtagta tgttcaatta gcttttcaat

          301 tatgaatata tatatcaatt attggtcgcc cttggcttgt ggacaatgcg ctacgcgcac

          361 cggctccgcc cgtggacaac cgcaagcggt tgcccaccgt cgagcgccag cgcctttgcc

          421 cacaacccgg cggccggccg caacagatcg ttttataaat tttttttttt gaaaaagaaa

          481 aagcccgaaa ggcggcaacc tctcgggctt ctggatttcc gatccccgga attagagatc

          541 ttggcaggat atattgtggt gtaacgttat cagcttggta cgtacccccc tactccaaaa

          601 atgtcaaaga tacagtctca gaagaccaaa gggctattga gacttttcaa caaagggtaa

          661 tttcgggaaa cctcctcgga ttccattgcc cagctatctg tcacttcatc gaaaggacag

          721 tagaaaagga aggtggctcc tacaaatgcc atcattgcga taaaggaaag gctatcattc

          781 aagatgcctc tgccgacagt ggtcccaaag atggaccccc acccacgagg agcatcgtgg

          841 aaaaagaaga cgttccaacc acgtcttcaa agcaagtgga ttgatgtgac atctccactg

          901 acgtaaggga tgacgcacaa tcccactatc cttcgcaaga cccttcctct atataaggaa

          961 gtcatttcat ttggagagga cagcccaagc tgagctccac cgcggtggcg gccgctctag

         1021 aactagtgga tcccccgggc tgcaggaatt cgatatcaag cttatcgata ccgtcgacct

         1081 cgaggggggg cccggtacca attcggtacg ctgaaatcac cagtctctct ctacaaatct

         1141 atctctctct attttctcca taaataatgt gtgagtagtt tcccgataag ggaaattagg

         1201 gttcttatag ggtttcgctc atgtgttgag catataagaa acccttagta tgtatttgta

         1261 tttgtaaaat acttctatca ataaaatttc taattcctaa aaccaaaatc cagtactaaa

         1321 atccagatcc actagccttg acaggatata ttggcgggta aactaagtcg ctgtatgtgt

         1381 ttgtttgaga tctcatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg

         1441 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct

         1501 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa

         1561 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc

         1621 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt

         1681 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg

         1741 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg

         1801 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct

         1861 tgaagtggtg gcctaactac ggctacacta gaagaacagt atttggtatc tgcgctctgc

         1921 tgaagccagt taccttcgga agaagagttg gtagctcttg atccggcaaa caaaccaccg

         1981 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc

         2041 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt

         2101 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa

         2161 aatgaagttt taaatcaatc taaagtatat atgtgtaaca ttggtctagt gattagaaaa

         2221 actcatcgag catcaaatga aactgcaatt tattcatatc aggattatca ataccatatt

         2281 tttgaaaaag ccgtttctgt aatgaaggag aaaactcacc gaggcagttc cataggatgg

         2341 caagatcctg gtatcggtct gcgattccga ctcgtccaac atcaatacaa cctattaatt

         2401 tcccctcgtc aaaaataagg ttatcaagtg agaaatcacc atgagtgacg actgaatccg

         2461 gtgagaatgg caaaagttta tgcatttctt tccagacttg ttcaacaggc cagccattac

         2521 gctcgtcatc aaaatcactc gcatcaacca aaccgttatt cattcgtgat tgcgcctgag

         2581 cgagacgaaa tacgcgatcg ctgttaaaag gacaattaca aacaggaatc gaatgcaacc

         2641 ggcgcaggaa cactgccagc gcatcaacaa tattttcacc tgaatcagga tattcttcta

         2701 atacctggaa tgctgttttc cctgggatcg cagtggtgag taaccatgca tcatcaggag

         2761 tacggataaa atgcttgatg gtcggaagag gcataaattc cgtcagccag tttagtctga

         2821 ccatctcatc tgtaacaaca ttggcaacgc tacctttgcc atgtttcaga aacaactctg

         2881 gcgcatcggg cttcccatac aatcggtaga ttgtcgcacc tgattgcccg acattatcgc

         2941 gagcccattt atacccatat aaatcagcat ccatgttgga atttaatcgc ggccttgagc

         3001 aagacgtttc ccgttgaata tggctcataa caccccttgt attactgttt atgtaagcag

         3061 acagttttat tgttcatgat gatatatttt tatcttgtgc aatgtaacat cagagatttt

         3121 gagacacaac gtggctttgt tgaataaatc gaacttttgc tgagttgaag gatcagatca

         3181 cgcatcttcc cgacaacgca gaccgttccg tggcaaagca aaagttcaaa atcaccaact

         3241 ggtccaccta caacaaagct ctcatcaacc gtggctccct cactttctgg ctggatgatg

         3301 gggcgattca ggcgatcccc atccaacagc ccgccgtcga gcgggct


    Product is for research use only!